پایان نامه درباره بررسی، دقیقه، افرادی

است، غلظت DNA و پروتئین هر نمونه بر حسب میکروگرم بر میلی‌لیتر در طول موج‌های:nm260وnm280تعیین شد.
همچنین نسبت جذب در طول موج nm260بهnm280جهت بررسی درجه خلوص DNAاستخراج شده تعیین شد و با انتخاب نمونه‌هایی که در آن‌ها? A260/280< 2 بود، از خلوص DNA‌های استخراج شده اطمینان حاصل شد. بررسی جایگاه(A>T) Tru9I:
جهت تکثیرقطعه ژن مورد نظر با استفاده از روش PCRیک مخلوط 20 میلی‌لیتری شامل:
2 واحد(? 30 /0)آنزیم Smart Taq(شرکت سیناژن ایران)،
2میکرولیتر?2 از بافر Smart Taq 1x
? 5/2 پرایمر(FOrward) 400 نانومولی(5′- GCAGGGTACAAAACTTTGGA G3′)
? 5/2پرایمر(Revers)400 نانومولی(5′ CCTCATCATCACCGACATCATGTC-3′)
200 میکرومولار(?4/0)ازdNTP
5/1 میلی مولار(?5/0)Mgcl2
mgCl2 25 (? 6/2 )از DNA
و در آخر آب دیونیزه برای رساندن حجم کلی به 15 میکرولیتر تهیه شد سپس در دستگاه ترموسایکلر (MWG- PRIMUS Biotech)قرار داده شد
برنامهPCR انجام شده به این قرار بود:
1)Denatorationیا دگرگونی94درجه به مدت 1 دقیقه
2) تعدادچرخه یاLoop( 35
3)Denatoration یادگرگونی دناتوریشن 94 درجه به مدت 30 ثانیه
4)Annealing یا چسبیدن69 درجه 30 ثانیه
5) extentionیا توسعه 72درجه30 ثانیه
6) LOOP )
7) extationl یا توسعه 72 درجه 7 دقیقه
8)Storage8 درجه 30 دقیقه
اجرای این برنامه منجر به تکثیر یک قطعه 177 جفت بازی گردید
سپس محصولات تکثیر شده با روش RFLPو به وسیل? آنزیم محدود کنند?‌Tru9I برنده توالی:
(( 5′-GGATG-3′: 5′-CATCC-3’برش خورده سپس روی ژل آگارز 2% تفکیک شد و پس از رنگ‌آمیزی توسط اتیدیوم بروماید توسط دستگاه ترانس لومیناتور SYNGENE و سیستم ژل داک(INGENIUSSYNGENE BIO IMAGING)عکسبرداری شد.
ژنوتیپ‌ها خوانده شد، افرادی که تنها دارای یک باندbp177بودند UUو افرادی که دارای 3 باند bp177، bp91و bp86بودند Uuیا هتروزیگوت و افرادی که دارای دو باند bp91، bp86بودندuuیا هوموزیگوتنامگذاری شدند
روش‌های کنترل کیفی:
از مارکر 100 (100 bp DNA Lodder) شرکت Fermentase برای بررسی طول قطعات جدا شده در مراحل آزمون‌های PCR و RFLPاستفاده شد. و برای کنترل تست سنجش ویتامین D از The LIAISON 25(OH) Vitamin D

دیدگاهتان را بنویسید